Expression Recipes¶
The following recipes assume the following context:
{ "record": { "variant": "GRCH37-5-36241637-36241637-C", "gene": "NADK2", "genomic_coordinates": { "build": "GRCH37", "chromosome": "5", "start": 36241637, "stop": 36241637 } } }
Retrieve a variant's allele frequency from ExAC
dataset_field_values('solvebio:public:/ExAC/1.3.0-r0.3/ExAC-GRCh37', 'af', entities=[('variant', record.variant)])
Retrieve a variant's clinical significance from ClinVar
dataset_field_values('solvebio:public:/ClinVar/3.7.4-2017-01-30/Combined-GRCh37', 'clinical_significance', entities=[('variant', record.variant)])
Calculate the prevalence of a gene within a multi-sample dataset
prevalence('solvebio:public:/TCGA/1.2.0-2015-02-11/SomaticMutations-GRCh37', entity=('gene', record.gene), sample_field='patient_barcode')
Normalize a variant (trim and left-shuffle the variant)
normalize_variant(record.variant)
Beacon public datasets for a variant
beacon(record.variant, 'variant', visibility='public')
Calculate the top terms for a string field in a dataset
dataset_field_top_terms('solvebio:public:/ClinVar/3.7.4-2017-01-30/Combined-GRCh37', 'clinical_significance')
Calculate statistics about a numeric field in a dataset
dataset_field_stats('solvebio:public:/ClinVar/3.7.4-2017-01-30/Combined-GRCh37', 'clinical_significance')
Predict the effects of a variant on genes, transcripts, and proteins
predict_variant_effects(record.variant)
Retrieve the sequence of a particular genomic region
genomic_sequence('GRCH37-5-36241600-36241660') # output # CCAGCTGCTTCAGGTCCTCCTCCGAGAGCTCCGCGTAACGGTACCGCTGCTGCTCGAACTC
Get the reverse complemented sequence of a particular genomic region
''.join(reversed([{ 'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C' }.get(nuc) for nuc in genomic_sequence('GRCH37-5-36241600-36241660')])) # output # GAGTTCGAGCAGCAGCGGTACCGTTACGCGGAGCTCTCGGAGGAGGACCTGAAGCAGCTGG
Find the GENCODE genes that overlap a genomic region
dataset_field_values('solvebio:public:/GENCODE/2.2.0-24/GENCODE-GRCh37', 'gene_symbol', entities=[('genomic_region', record.genomic_coordinates)], filters=[('feature', 'gene'), ('gene_type', 'protein_coding'), ('gene_status', 'KNOWN')])
Split a string by whitespace or specific delimiter
split(record.variant, '-')
Yaml format¶
To create a new recipe write it in yaml format as described in the example below:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 | recipes: - name: cDNA Change version: 1.0.0 description: Gets the cDNA change from the variant field is_public: true fields: name: cdna_change data_type: string expression: | get(translate_variant(record.variant),'cdna_change') if record.variant else None - name: dbSNP description: Adds dbsnp ids using the variant record from a dataset - supports both GRCh37 and GRCh38 version: 1.0.0 is_public: true fields: name: gene data_type: string entity_type: gene is_list: true expression: | dataset_field_values( 'solvebio:public:/dbSNP/2.0.0-b151/Variants-{}'.format(get(record, 'genomic_coordinates.build')), field='row_id', entities=[('variant', record.variant)]) if get(record, 'variant') else None |
Publishing new and updating existing recipes¶
To publish recipe to the SolveBio use solvebio-recipes client from the command line:
If you want to create/update only one of the recipes from the provided yaml file, use command --name:
1 | solvebio-recipes sync --name "dbSNP (v1.0.0)" path/to/yaml/file
|
If you want to create/update all of the recipes from the yaml file, use command --all:
1 | solvebio-recipes sync --all path/to/yaml/file |
You can also delete the existing recipes with the following command:
1 | solvebio-recipes delete --name "dbSNP (v1.0.0)" path/to/yaml/file
|
In all of described cases, you will be prompted to confirm your choice.
Export of the existing recipes¶
Export of the existing recipes in SolveBio is possible using the same solvebio-recipes export command.
It is possible to export public and account recipes in a yaml file.
To export public recipes into yaml format use the following command:
1 | solvebio-recipes export --public-recipes path/to/yaml/file
|
Otherwise, to export account recipes, use:
1 | solvebio-recipes export --account-recipes path/to/yaml/file
|
Please, make sure that you specify different yaml files for public and account recipes!